CRISPR-Cas9 editing of synaptic genes in human embryonic stem cells for functional analysis in induced human neurons (2024)

• •

  Protocol for custom gRNA design and assembly into LentiCRISPR v2

• •

  Transient transfection and single-cell cloning of hESCs

• •

  Validation of gene editing and individual allele screening of hESCs

• •

  Steps for the induction of WT and edited hESCs into functional neurons using neurogenin-2

Institutional permissions

Users of this protocol will require institutional permission to use human embryonic stem cells and laboratory animals. All animal procedures were performed in accordance with the guide for the care and use of laboratory animals and approved by the Institutional Animal Care and Use Committee at Vanderbilt University.

gRNA design

Timing: 1 h

Proper gRNA design is crucial for genome targeting specificity and subsequent Cas9 cleavage of the desired gene target. This section explains how to design gRNAs that can be rapidly assembled into a LentiCRISPR v2 plasmid.

• 1.

  Import mRNA sequence (GenBank: NM_XXXX), and each exon FASTA seq (GenBank: NM_XXXX exons) of a gene of interest from the NCBI database to Benchling.com.

  • a.

    Use Benchling integrated gRNA design program to design gRNAs targeting the exon containing the coding sequence (CDS).

Note: gRNAs should target regions immediately downstream of the CDS containing exon.

• 2.

  Select up to 4 gRNAs (20 nucleotide length) based on the on-target and off-target scores,3 targeting different regions downstream of the CDS.

CRITICAL: Selecting gRNAs with on-target and off-target scores of 80 or higher in the program is essential for target specificity and successful genome editing.

• 3.

  For gRNA cloning into LentiCRISPR v2, the sense oligonucleotide sequence is CACC (overhang for golden gate assembly), G (transcription start site), and N20 (gRNA target).4

  Note: Example: CACCG (CCCTCGGGGCGCTGTGCTGT)

  • a.

    The antisense oligo is AAAC (overhang for golden gate assembly), N20 (gRNA reverse complement), and C (antisense of the transcription start site).

    Note: Example: AAAC (ACAGCACAGCGCCCCGAGGG) C.4

    Alternatives: Using Benchling for gRNA design is a very effective approach in our practice. Besides Benchling, we do not have experience working with other sequence analysis and gRNA design tools. Still likely, using those tools could also work as an alternative approach for this purpose. Users can make their own decisions.

Cell culture

Timing: 1month

These steps are general instructions for thawing and passaging human embryonic kidney (HEK) cells and hESCs and do not need to be maintained throughout this protocol. Ideally, hESCs or HEK cells are thawed and passaged at least two times before subsequent transfection.

Neuronal induction media

Neuronal selection media

Neurobasal media

Neuronal growth media

gRNA phosphorylation, annealing, and golden gate assembly

Timing: 1–2days

These steps describe the process of assembling the gRNA oligonucleotides designed using Benchling.com with the added overhangs into the LentiCRISPR v2 expression vector using golden gate assembly. We detail the steps to complete phosphorylation and annealing of oligonucleotides, which facilitate ligation into LentiCRISPR v2.

• 1.

  Phosphorylation and annealing of gRNA oligonucleotides:

Note: 10X T4 PNK buffer is from a commercial kit (see key resources table for catalog information).

• 2.

  Add 90μL ddH₂O to each reaction to bring the final volume to 100μL after phosphorylation and annealing.

Note: The following reaction mix utilizes the restriction enzyme Esp3I. Two Esp3I restriction sites are located on the LentiCRISPR v2 plasmid and generate complementary overhang sequences to those in the previously design gRNA sequences.

• 3.

  Clone gRNAs into LentiCRISPR v2 using golden gate assembly:

Note: T4 ligase buffer is from a commercial kit (see key resources table for catalog information).

Alternatives: BsmBI-v2 may be used as an alternative enzyme to Esp3I. However, the cloning must be done at 55°C as opposed to 37°C for Esp3I.

Note: Following golden gate assembly, plasmids may be stored at 4°C or at −20°C for long-term storage.

Testing gRNA editing efficiency using T7 endonuclease assay in HEK cells

Timing: 4days

This section explains the steps involved in determining the relative editing efficiency of multiple gRNAs targeting a single gene of interest using a rapid T7 endonuclease assay in HEK cells. T7 endonuclease recognizes and cleaves mismatched DNA, allowing users to determine the relative efficiency of gRNA editing using the relative amount of cleaved DNA following gRNA editing and T7 endonuclease digestion. Pre-determining gRNA efficiency enhances the probability of successful genome editing in hESCs.

• 4.

  Transform 2μL of the assembled gRNAs– LentiCRISPR v2 plasmid from step 3 into DH5α Competent E.coli by following the company instructions without any modifications to the provided commercial protocol. Brief steps are described below.

  • a.

    Thaw DH5α on ice for 10min and add 100ng of LentiCRISPR v2 plasmid to the tube. Carefully flick the tube and place it on ice for 30min.

  • b.

    Heat shock at exactly 42°C for 30 s. Rest on ice for 5min.

  • c.

    Add 1mL of outgrowth medium (in the kit) and allow cells to recover at 37°C for 1h while rotating at 250rpm.

  • d.

    Spread 100μL onto pre-warmed LB agar+Ampicillin (100μg/mL) plates and incubate at 37°C O/N.

• 5.

  Pick two bacterial colonies for each transformed gRNA and use a Mini-prep kit to grow and purify the plasmid DNA. Follow the company-provided protocol without any modifications. Brief steps are described below.

  • a.

    Pellet 1.2mL bacterial culture by centrifuging at 7,000×g for 3min.

  • b.

    Resuspend pelleted bacterial cells in 250μL Buffer P1. Add 250μL Buffer P2 and mix thoroughly by inverting the tube until the solution becomes clear.

  • c.

    Add 350μL Buffer N3 and mix thoroughly by inverting the tube.

  • d.

    Centrifuge for 10min at ∼17,000×g and transfer supernatant to the spin column provided by the kit. Centrifuge for 1min and discard the flow-through.

  • e.

    Add 750μL Buffer PE to wash. Centrifuge for 1min and discard the flow-through.

  • f.

    Elute DNA in 50μL Buffer EB by centrifuging for 1min.

• 6.

  Sanger-sequence the plasmid with the LentiCRISPR v2 primer (see key resources table) to confirm gRNA sequence insertion into the vector.

• 7.

  Transfect one well of a 6-well plate of HEK cells using 6μL FuGENE 6 transfection reagent mixed with 1.5μg LentiCRISPR v2 plasmid with validated gRNA sequence from step 6.

  • a.

    Incubate the mixture of FuGENE6 and plasmid in 100μL Opti-MEM for 15min at 20°C.

  • b.

    Add the mixture drop-wise to HEK cells and incubate at 37°C.

  • c.

    Change media to fresh DMEM+ after 24h of incubation with transfection complexes and incubate at 37°C for an additional 48 h.

• 8.

  Extract the genomic DNA of transfected HEK cells using a DNeasy blood and tissue kit for each gRNA transfection. Follow the company-provided protocol without any modifications. Brief steps are described below.

  • a.

    Centrifuge at 300×g for 5min to collect cells and resuspend in 200μL PBS (add 20μL proteinase K from the kit).

  • b.

    Add 200μL Buffer AL and mix thoroughly by vortexing.

  • c.

    Add 200μL 100% ethanol and mix thoroughly by vortexing.

  • d.

    Pipet the mixture into a DNeasy Mini spin column and centrifuge at 6,000×g for 1min. Discard the flow-through.

  • e.

    Add 500μL Buffer AW1 and centrifuge at 6,000×g for 1min. Discard the flow-through.

  • f.

    Add 500μL Buffer AW2 and centrifuge at 20,000×g for 3min. Discard the flow-through.

  • g.

    Elute the DNA by adding 200μL buffer AE to the center of the spin column membrane. Incubate for 1min and centrifuge at 6,000×g for 1min.

Note: Alternative transfection reagents such as calcium phosphate may be used for HEK transfection, but FuGENE 6 is recommended for optimal transfection efficiency.

CRITICAL: Passage cells 1 day before transfection so that they are approximately 75% confluent at the time of transfection.

• 9.

  PCR amplify the target CDS region in the gene of interest.

Note: Ideal primers for this reaction should generate a 600bp amplicon with the gRNA target toward the middle of the PCR product so that T7 digestion generates a 200–300bp fragment (see troubleshooting problems 1 and 4).

Note: The 5X Q5 reaction buffer is from a commercial kit (see key resources table for catalog information).

Note: The Q5 DNA polymerase rate is 30 s/kb. Users may need to adjust the extension time accordingly based on the size of the PCR product.

• 10.

  Run a 1% agarose gel (dissolve 1g of agarose in 100mL TAE buffer) with 10μL PCR product for 30min at 120V to confirm the PCR product is the right size.

• 11.

  As purified PCR products are required to achieve ideal results in the T7 reaction, we purify the remaining PCR product with a Promega PCR cleanup system by following the company-provided protocol without any modifications. Brief steps are described below.

  • a.

    Add an equal volume of membrane binding solution to the PCR product.

  • b.

    Transfer the mixture to the mini-column assembly (in the kit) and centrifuge for 1min at 16,000×g.

  • c.

    Add 700μL membrane wash solution to the column and centrifuge for 1min at 16,000×g.

  • d.

    Repeat the previous step with 500μL membrane wash solution and centrifuge for 5min at 16,000×g.

  • e.

    Elute PCR product in 50μL nuclease-free water by centrifuging for 1min at 16,000×g.

• 12.

  Quantify the concentration using a NanoDrop 2000 spectrophotometer (Thermo Fisher).

• 13.

  Run a T7 endonuclease I assay to determine genome targeting efficiency by cutting mismatched double strands.

• 14.

  Add 1μL T7 endonuclease to 19μL annealed PCR product and incubate at 37°C for 15min.

• 15.

  Run the T7 digested PCR products on a 1% agarose gel for approximately 30min at 120 V. Select the plasmid that generates a relatively high cleavage product following T7 digestion (Figure1).

  Open in a separate window

  Figure1

  Relative editing efficiency of different gRNAs following T7 assay in HEK cells

  Visualization of gRNA efficiency following T7 assay in HEK cells. Lane 1: 1 Kb DNA ladder; Lane 2–3: two replicates of gRNA #1 transfected HEK cells; Lane 4–5: two replicates of gRNA #2; Lane 6–7: two replicates of gRNA #3, Lane 8–9: non-transfected HEK cells, Lane 10: 1 Kb DNA ladder. gRNA #2 produced the highest intensity of the smaller T7 product compared to two other gRNAs, so gRNA #2 may have the highest editing efficiency compared to the other gRNAs.

• 16.

  Choose the LentiCRISPR v2 plasmid that resulted in the highest percentage of T7 cleavage product and transform this plasmid into DH5α Competent E.coli as described in step 4.

  • a.

    Use a Midi-prep kit to purify the desired LentiCRISPR v2 plasmid for downstream transfection of hESCs. Refer to step 5 for general kit instructions.

Pause point: The prepared gRNA plasmids can be stored at −20°C while preparing hESC cultures.

hESC transient transfection and clone isolation

Timing: 4weeks

These steps describe how to transfect hESCs with the assembled and T7-tested LentiCRISPR v2 plasmid. This section also details selecting for transient plasmid expression using puromycin and subsequent single-cell cloning and re-expansion of edited hESC lines.

• 17.

  Maintain hESCs in mTeSR Plus media using 6-well plates (see hESC culture in the “cell culture” section).

• 18.

  Passage hESCs with Accutase one day before transfection. Brief steps are described below.

  • a.

    Aspirate media and rinse wells with 1mL of PBS.

  • b.

    Add 1mL of Accutase to the well and incubate at 37°C for 10min.

  • c.

    Collect and centrifuge cells for 5min at 300×g. Aspirate Accutase from the pellet and resuspend in fresh mTesR Plus+ ROCKi.

  • d.

    Seed hESCs as single cells at 70%–80% confluence in a 6-well plate (add 10μM ROCKi to support single-cell survival).

Note: Accutase is a gentle dissociation reagent that promotes the dissociation of hESCs as single cells unlike ReLesR, which promotes the dissociation of hESCs in colonies.

CRITICAL: Passaging hESCs at approximately 70% confluence and maintaining hESCs with less than 5% visible differentiation (Figure2C) are ideal for transfection and downstream cell line propagation.

Open in a separate window

Figure2

Example images of hESC colonies after selection and expansion for 10days in a 10cm dish

(A) Example of an optimal colony to be isolated and analyzed for gene editing with distinct borders and minimal to no contact with neighboring colonies.

(B and C) Example colonies to avoid isolating with visible signs of differentiation (C)or contact with neighboring colonies (B). Scale bar= 267.8μm.

• 19.

  Transfect hESCs with 2.5μg of the LentiCRISPR v2 plasmid mixed with 7.5μL of Lipofectamine per well of a 6-well plate using Lipofectamine 3000 for optimal transfection efficiency by following the company instructions. Brief steps are described below.

  • a.

    Incubate the mixture of Lipofectamine and plasmid in 250μL Opti-MEM for 15min at 20°C.

  • b.

    Add the mixture drop-wise to hESCs and incubate at 37°C.

• 20.

  Change media to fresh mTesR Plus after 24h and incubate cells at 37°C for an additional 24 h.

• 21.

  Change media to selection media (mTESR Plus with 1μg/mL puromycin) for 24 h.

• 22.

  Replace selection media with mTesR Plus+ CloneR2 supplement to support the growth of surviving single hESCs after selection.

• 23.

  Allow surviving hESCs to recover for 3–5days in mTesR Plus+ CloneR2.

Note: If hESCs begin to proliferate after 3days, it is not necessary to wait until 5days before proceeding to clone isolation.

• 24.

  Change media to fresh mTeSR Plus+ CloneR2 every two days.

• 25.

  Coat one 10cm dish with Matrigel (100ng/mL) for 24h at 37°C.

• 26.

  Dissociate recovered hESCs using Accutase (refer to step 18).

  • a.

    Pellet and resuspend hESCs in 1mL mTesR Plus+ CloneR2.

• 27.

  Determine the volume equivalent to 1000 cells using a hemocytometer or automated cell counter.

Note: Users may find the volume equivalent to 1000 cells too small to work with comfortably. Diluting the resuspended pellet by a factor of 5 or 10 will increase the volume equivalent to 1000 cells added to a 10cm dish.

• 28.

  Aspirate Matrigel from a 10cm dish, seed 1000 single cells to the 10cm dish, and incubate at 37°C.

• 29.

  Change media to fresh mTeSR Plus+ CloneR2 on day 3 and day 6 post-seeding.

• 30.

  Pick colonies that grow to a considerable size of approximately 0.5–1mm in diameter (usually one week after seeding single cells) (Figure2A). Use a sterile 20-gauge needle to cut the colony in a grid pattern. Use a p200 pipette tip to pick up the pieces and transfer them to a single well of a Matrigel-coated 24-well plate.

• 31.

  Isolate at least 12 candidate clones and ensure each clone is seeded in one different well of a 24-well plate.

Note: Large colonies or colonies with irregular shapes may indicate cell growth from multiple hESCs in close proximity (see troubleshooting problem 2).

CRITICAL: Avoid picking colonies with visible differentiation or colonies that have merged with neighboring colonies to ensure hESC stemness and clonal purity (Figures2B and 2C).

• 32.

  After reaching 70% confluence in a 24-well plate (usually one week post-seeding), use Accutase to collect all cells of each clone and passage them to two wells of a Matrigel-coated 6-well plate.

Note: One well is used for cryopreservation, and the other is used for DNA extraction and gene editing validation.

• 33.

  After one week of the culture in mTeSR Plus+ CloneR2, or when the candidate clone has reached 70%–80% confluence, cryopreserve one well of confluent hESCs using mFreSR. The other well of hESCs will be used for the screening procedure beginning at step 36.

• 34.

  Cryopreserve hESCs in mFreSR by dissociating hESCs using ReLesR and centrifuging for 5min at 300×g. Aspirate media from the pellet and resuspend the pellet in 1mL of mFreSR.

• 35.

  Transfer 1mL of hESCs in mFreSR to a cryopreservation vial and place in −80°C.

CRITICAL: Gentle but thorough trituration of hESCs in mFreSR is essential to ensure hESC colonies are dissociated and exposed to the freezing media.

Note: Screening a minimum of 12 candidate hESC clones for each gRNA will result in a higher probability of identifying at least one successfully edited cell line.

hESC clone screening and validation of gene knockout

Timing: 1–2weeks

This step details the process of isolating genomic DNA from candidate hESC clones and subsequent verification of genome editing in hESCs.

• 36.

  Rinse hESCs with 1mL of PBS.

• 37.

  Add 1mL of Accutase to each well and incubate for 10min at 37°C.

• 38.

  Collect hESCs in Accutase and centrifuge at 300×g for 5min to pellet cells. Aspirate the media from the cell pellet.

• 39.

  Extract genomic DNA from the cell pellet using DNeasy blood and tissue kit (refer to step 8).

• 40.

  PCR amplify the gRNA target site from hESC genomic DNA following the same procedure performed in HEK cells (refer to step 9).

Note: Ensure the use of CDS-specific primers with pBlueScript overhang sequences (key resources table) for the subsequent subcloning of the PCR product into pBlueScript at EcoRV sites.

• 41.

  Purify PCR product using the Promega PCR cleanup system (Refer to step 11).

• 42.

  Sequence the purified PCR products using Sanger sequencing.

• 43.

  Perform alignment of sequencing results to reference genome by uploading the DNA sequencing to Benchling and aligning them to a reference WT genome sequence from the NCBI gene.

  • a.

    Insertions or deletions in the user’s DNA sequence will appear in red, while aligned nucleotides will correspond to the reference genome sequence (Figure3).

    Open in a separate window

    Figure3

    Candidate clone sequencing and individual allele screen of CRISPR KO hESCs

    Sanger sequencing of the candidate clone shows a high degree of DNA base uncertainty around the Cas9 cut site, indicating the potential occurrence of gene editing. Further sequencing of individual PCR products cloned into pBlueScript from this candidate hESC clone reveals a 1 (PTC generating) and 12bp (non-PTC generating) deletion.

• 44.

  Select candidate clones with edits that potentially generate a nonsense mutation leading to premature stop codons in the coding sequence.

  • a.

    Indels not divisible by 3 are ideal candidates for downstream validation, as these types of indels create frameshift mutations in the mRNA sequence, leading to a truncated peptide and non-functional protein. (See troubleshooting problem 3).

• 45.

  To identify the genotypes after gene editing, subclone individual PCR products from promising candidate clones into EcoRV-digested pBlueScript vector described in steps 46–48.

• 46.

  To digest pBlueScript with EcoRV, set up digests with no more than 1μg of pBlueScript per 20μL in 1X NEB rCutSmart Buffer. Add 0.5μL EcoRV per 1μg of pBlueScript and digest for 2–3h at 37°C.

• 47.

  Run all 20μL of the digested plasmid on a 1% agarose gel (refer to step 10) and extract and purify the 3 kb band of EcoRV-digested pBlueScript vector using a DNA gel extraction kit. Brief steps are described below.

  • a.

    Excise the DNA fragment from the gel and add 3 volumes of Buffer QG to the gel fragment.

  • b.

    Incubate at 50°C for 10min and add 1 gel volume of isopropanol to the mixture.

  • c.

    Transfer the mixture to a spin column and centrifuge for 1min at 16,000×g.

  • d.

    Add 750μL Buffer PE and centrifuge for 1min at 16,000×g.

  • e.

    Elute DNA by adding 50μL Buffer EB and centrifuge for 1min at 16,000×g.

• 48.

  Ligate the PCR product from candidate hESCs into the digested and purified pBlueScript prepared in steps 46–47:

Note: The 2X HiFi DNA assembly mix is from a commercial kit (see key resources table).

• 49.

  Transform 2μL of reaction to DH5α Competent E.coli. and plate on LB+ Ampicillin plates and incubate at 37°C for 18h (refer to step 4).

• 50.

  Pick 6 colonies for each candidate hESC clone and directly add to PCR tubes described below:

• 51.

  Purify PCR product using ExoSAP-IT:

• 52.

  Sequence PCR products and align each (6 sequences per clone) to the wild-type reference genome (see troubleshooting problem 5).

  • a.

    Evidence of hom*ozygous or heterozygous indels can be assessed through the distribution of insertions or deletions in multiple sequence alignments for a single hESC clone.

Direct reprogramming of hESCs into mature human neurons

Timing: 5weeks

To study the role of synaptic genes in neurotransmission of mature neurons, the verified hESC knockout will be differentiated into induced human neurons (iNs). This step describes how to directly reprogram hESCs into functional neurons using over-expression of human neurogenin-2 (hNgn2) (Figure4). This induced human neuron platform will allow users to investigate the functional consequences of the knockout generated in hESCs and employ a variety of assays in human neurons to uncover the functional changes in neural signaling as a consequence of the gene knockout.

• 53.

  (Day-1) Use Accutase to collect confluent hESCs (refer to step 18).

• 54.

  Generate lentiviral particles by transfecting HEK-293T cells in a T-75 flask with three lentiviral packaging constructs (pRSV-REV; pMD2.G; pMDLg/pRRE; each 5μg in Opti-MEM) and hNgn2 construct (pFUW-TetO-hNgn2-EGFP-PuroR; 10μg in DMEM) using FuGENE 6 (refer to step 7).

  • a.

    Change DMEM+ media to mTeSR plus media 16h after transfection.

  • b.

    Wait for another 48h and collect lentivirus-containing media for transduction. The typical titer from the supernatant is ∼ 1×10⁶ IU/mL.

• 55.

  Seed ∼3×10⁶ hESCs as single cells to one Matrigel-coated 6-well plate in mTeSR Plus culture media containing hNgn2 expressing lentiviral particles with polybrene (final concentration 8μg/mL) and ROCK inhibitor (Y-27632, final concentration 10μM).

  • a.

    In each well of a 6-well plate, add 1.5mL fresh mTeSR Plus media and 0.5mL of lentivirus-containing media collected from HEK cell culture so that the desired multiplicity of infection is between 1 and 2.

• 56.

  (Day 0) After 16–24 h, replace mTesR plus media with neuronal induction media.

• 57.

  (Day 1) 24h later, replace the induction medium with neuronal selection media for 48 h.

Note: The duration of puromycin selection varies with lentiviral infection efficiency and can be optimized. However, the 48-h selection is recommended to obtain pure iN populations.

• 58.

  Isolate mouse astrocytes by dissecting mouse pup forebrains and culture mouse primary astrocytes with DMEM+ media in a T-75 flask by following an existing detailed protocol.5

  • a.

    Passage astrocytes at least once with 0.25% Trypsin-EDTA before using them for induced neuron co-culture.

Note: Astrocytes are essential for the development and maturation of functional neural networks and are an essential cell type to co-culture with induced neurons to achieve long-term functional viability.

• 59.

  (Day 2) Seed ∼1×10⁵ mouse astrocytes to each well of a 24-well plate in Neurobasal plus media supplemented with FBS (final FBS concentration is 10%).

Note: Neurotrophic supplements are not needed for astrocyte growth in 24-well plates prior to seeding iN cells.

• 60.

  (Day 3) Aspirate the selection medium and collect iN cells using Accutase from one 6-well plate (refer to step 18).

  • a.

    Resuspend the cell pellet in Neurobasal media and use a cell counter to determine the total number of iNs.

  • b.

    After counting iNs, plate approximately 1×10⁵ cells per well in a 24-well plate with mouse astrocytes added on day 1 in neurobasal media with supplements.

• 61.

  (On day 6& 8) replace half of the media in each well with fresh neurobasal media.

• 62.

  (On day 10& 13) Change half of the media to neuronal growth media.

• 63.

  Change half of the growth media in each well weekly (days 20, 27, and 34). iNs are assayed for electrophysiology and imaging between 35-50days post-transduction (Figure5).6

  Open in a separate window

  Figure5

  Representative images of human neural progenitors at Day 13 and mature neurons at Day 40 after lentiviral transduction of hNGN2-P2A-EGFP

  EGFP fluorescence shows the morphology of immature human neurons at Day 13 and mature neurons at Day 40 after hNGN2 overexpression in hESCs. Scale bar= 200μm.

Validating gene knockout and function in mature iNs

Following neural induction and confirmation of Ngn2 expression through visualization of GFP fluorescence, users can employ assays in mature iNs to validate the loss of synaptic protein function. As shown below, we used immunostaining to verify the loss of the synaptic vesicle protein (Syt1) and employed patch-clamp electrophysiology to validate the deficit in neurotransmission in Syt1 KO iNs (Figure6).

Problem 1

Low gRNA efficiency in T7 assay.

Potential solution

• •

  Ensure designed gRNAs have the highest relative efficiency and on-target scores. Ideally, on-target and off-target scores should be approximately 80 or higher (in Benchling) for ideal genome specificity and successful editing.

• •

  Design new gRNAs to target different exons.

• •

  Transfect HEK cells at lower confluency to increase the probability of amplifying mutant HEK cell DNA.

• •

  Alternative transfection reagents such as Lipofectamine 3000 may enhance the transfection efficiency.

Problem 2

Stem cells start to differentiate following transient transfection.

Potential solution

• •

  Change media to fresh mTeSR Plus+ CLoneR2 every 24 h.

• •

  Off-target effects of gRNAs may contribute to hESC differentiation.

• •

  Selecting alternative gRNAs with high specificity scores may reduce hESC differentiation.

Problem 3

Lack of genome editing in hESCs with high gRNA transfection efficiency.

Potential solution

• •

  Increase the selection window with puromycin from 24 to 48 h.

• •

  Isolate >12 candidate hESCs following single-cell cloning.

• •

  Change media with fresh mTeSR Plus+ CLoneR2 every 24h to ensure mutant single cells can grow.

Problem 4

No PCR amplification of target site from genomic DNA.

Potential solution

• •

  Depending on the size of the PCR product, increase the extension time accordingly based on the Q5 DNA polymerase extension at the speed of 30 s/kb.

• •

  Ensure primers have low off-target binding and adequate CG content for Tm in cycling conditions.

Problem 5

Sequencing of individual PCR products from pBlueScript colonies.

Potential solution

• •

  Make sure to pick larger colonies on LB selection plates following plasmid transformation.

• •

  Using primers targeting the PCR insert as opposed to a region of the vector may increase the success of insert amplification.

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Ege T. Kavalali (ude.tlibrednav@ilalavak.ege).

Technical contact

Questions regarding the technical specifics of performing this protocol should be directed to and will be answered by the technical contact, Aiden Houcek (ude.tlibrednav@kecuoh.nedia).

Materials availability

The materials used and generated in this study are available from the lead contact upon reasonable request with a completed Materials Transfer Agreement. However, there are restrictions to the availability of plasmid reagents generated for this study due to the individualized cloning of gRNAs into expression vectors and gene targets of interest.

Data and code availability

No original code or any dataset has been generated in this study.

This work was supported by National Institutes of Health grants (R01 MH066198 to E.T.K. and R01 MH070727 to L.M.M.). Cartoon figures were generated using BioRender.com. We thank Natalie J. Guzikowski for comments and feedback on the protocol.

1. Veres A., Gosis B.S., Ding Q., Collins R., Ragavendran A., Brand H., Erdin S., Cowan C.A., Talkowski M.E., Musunuru K., Musunuru K. Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN targeted human stem cell clones detected by whole-genome sequencing. Cell Stem Cell. 2014;15:27–30. [PMC free article] [PubMed] [Google Scholar]

2. Zhang Y., Pak C., Han Y., Ahlenius H., Zhang Z., Chanda S., Südhof T.C., Patzke C., Acuna C., Covy J., et al. Rapid single-step induction of functional neurons from human pluripotent stem cells. Neuron. 2013;78:785–798. [PMC free article] [PubMed] [Google Scholar]

3. Hsu P.D., Scott D.A., Weinstein J.A., Ran F.A., Konermann S., Agarwala V., Li Y., Fine E.J., Wu X., Shalem O., et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 2013;31:827–832. [PMC free article] [PubMed] [Google Scholar]

4. Shalem O., Sanjana N.E., Hartenian E., Shi X., Scott D.A., Mikkelson T., Heckl D., Ebert B.L., Root D.E., Doench J.G., Zhang F. Genome-scale CRISPR-Cas9 knockoutscreening in human cells. Science. 2014;343:84–87. [PMC free article] [PubMed] [Google Scholar]

5. Schildge S., Bohrer C., Beck K., Schachtrup C. Isolation and Culture of Mouse Cortical Astrocytes. J.Vis. Exp. 2013;71 doi:10.3791/50079. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

6. Uzay B., Houcek A., Ma Z.Z., Konradi C., Monteggia L.M., Kavalali E.T. Neurotransmitter release progressively desynchronizes in induced human neurons during synapse maturation and aging. Cell Rep. 2023;42 [PMC free article] [PubMed] [Google Scholar]